Stem-loop sequence bdi-MIR169m

AccessionMI0029158 (change log)
DescriptionBrachypodium distachyon miR169m stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

3 open access papers mention bdi-MIR169m
(27 sentences)

Stem-loop
   -cucu              --- ug           ggccugcauauaugucucca 
5'      ucguguagccaagg   a  acuugccggcc                    a
        ||||||||||||||   |  |||||||||||                     
3'      aguacaucgguuuc   u  ugaacggcugg                    a
   ccguc              guu gu           aucgaacaauucgaacaauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 58636718-58636827 [+]
intergenic
Database links

Mature sequence bdi-miR169m

Accession MIMAT0035516
Sequence

10 - 

uagccaaggaugacuugccg

 - 29

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).