Stem-loop sequence bdi-MIR169n

AccessionMI0029159 (change log)
DescriptionBrachypodium distachyon miR169n stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

3 open access papers mention bdi-MIR169n
(27 sentences)

Stem-loop
   -cuga     -          u   u       -----   ug       -     a 
5'      uucgg uagccaagga gac ugccuaa     aug  ucuaugu aauuc u
        ||||| |||||||||| ||| |||||||     |||  ||||||| |||||  
3'      aggcu aucgguuccu cug acggauu     ugc  ggguacg uugag c
   ccgug     u          u   u       uuaau   ca       g     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 11346973-11347080 [-]
intergenic
Database links

Mature sequence bdi-miR169n

Accession MIMAT0035517
Sequence

10 - 

uagccaaggaugacuugccua

 - 30

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).