Stem-loop sequence bdi-MIR171e

AccessionMI0029160 (change log)
DescriptionBrachypodium distachyon miR171e stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

1 open access papers mention bdi-MIR171e
(2 sentences)

Stem-loop
   --    g  c         ga         c     u        -  u 
5'   gaag ag gauauuggu  gguucaauc gaugc agauuuua ca c
     |||| || |||||||||  ||||||||| ||||| |||||||| ||  
3'   cuuc uc cuauaaccg  ccgaguuag cuaug ucuagaau gu a
   uu    -  u         ug         u     -        u  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 30824648-30824742 [-]
intergenic
Database links

Mature sequence bdi-miR171e

Accession MIMAT0035518
Sequence

66 - 

ugauugagccgugccaauauc

 - 86

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).