Stem-loop sequence bdi-MIR171f

AccessionMI0029161 (change log)
DescriptionBrachypodium distachyon miR171f stem-loop
Gene family MIPF0000104; MIR171_2
Literature search

1 open access papers mention bdi-MIR171f
(2 sentences)

Stem-loop
   --acg      ca        u             - u  u   g u 
5'      acaugg  ugguauug uucggcucauguc c uc cga c g
        ||||||  |||||||| ||||||||||||| | || ||| |  
3'      uguacc  acuauaac aagccgaguguag g ag gcu g a
   ucuua      -c        c             a u  -   g u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
5: 21672257-21672347 [+]
intergenic
Database links

Mature sequence bdi-miR171f

Accession MIMAT0035519
Sequence

62 - 

ugagccgaaccaauaucaccc

 - 82

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).