Stem-loop sequence bdi-MIR395q

AccessionMI0029162 (change log)
DescriptionBrachypodium distachyon miR395q stem-loop
Gene family MIPF0000016; MIR395
Literature search

3 open access papers mention bdi-MIR395q
(31 sentences)

Stem-loop
   aau     u         g             -a   a  au 
5'    uauca gaguuccuu caagcacuucaug  ggc cu  c
      ||||| ||||||||| |||||||||||||  ||| ||   
3'    auagu cucaagggg guuugugaaguau  ucg ga  c
   acu     u         -             ca   g  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
5: 25456843-25456926 [+]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR395q
bdi-MIR395e5: 25455195-25455344 [+]
bdi-MIR395f5: 25455426-25455521 [+]
bdi-MIR395g5: 25455723-25455811 [+]
bdi-MIR395h5: 25455882-25455957 [+]
bdi-MIR395c5: 25455997-25456122 [+]
bdi-MIR395j5: 25456151-25456238 [+]
bdi-MIR395k5: 25456290-25456375 [+]
bdi-MIR395p5: 25456430-25456518 [+]
bdi-MIR395l5: 25456562-25456657 [+]
bdi-MIR395q5: 25456843-25456926 [+]
bdi-MIR395n5: 25457116-25457205 [+]
Database links

Mature sequence bdi-miR395q

Accession MIMAT0035520
Sequence

56 - 

ugaaguguuugggggaacuc

 - 75

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).