Stem-loop sequence bdi-MIR444b

AccessionMI0029165 (change log)
DescriptionBrachypodium distachyon miR444b stem-loop
Gene family MIPF0000402; MIR444
Literature search

1 open access papers mention bdi-MIR444b
(3 sentences)

Stem-loop
   -gauuc   ugc  c    c     a       a         u      u      a           cagcgaaacaugcauuacuugcgg 
5'       gca   gg ggca caagc ugaggcg caacugcau acuugc gggaag cgcaaguauga                        g
         |||   || |||| ||||| ||||||| ||||||||| |||||| |||||| |||||||||||                        a
3'       cgu   cc ccgu guucg acuccgu guugacgug ugaacg ucuuuc guguucauacu                        a
   cgagac   uuc  u    c     a       c         u      u      g           acuagaagauaagcaaaacgcgga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bdi-miR444b

Accession MIMAT0035523
Sequence

147 - 

ugcaguugcugccucaagcuu

 - 167

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).