Stem-loop sequence bdi-MIR530a

AccessionMI0029168 (change log)
DescriptionBrachypodium distachyon miR530a stem-loop
Gene family MIPF0000521; MIR530
Stem-loop
        a gg      uuuug          ac         --  u ga    --ac   --      a     ccuauuucau 
5' gaaga u  ugugau     cugcauuugc  cugcaccua  ca c  agga    gau  agaagc cugca          c
   ||||| |  ||||||     ||||||||||  |||||||||  || |  ||||    |||  |||||| |||||           
3' cuuuu a  acacua     gacguagacg  gacguggau  gu g  uccu    cua  ucuucg gacgu          a
        a gg      -ugug          gu         uc  c aa    ccuc   gu      -     acugcuauua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
5: 16956517-16956678 [-]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR530a
bdi-MIR530b5: 16956889-16957043 [-]
bdi-MIR530a5: 16956517-16956678 [-]
Database links

Mature sequence bdi-miR530a

Accession MIMAT0035526
Sequence

22 - 

ugcauuugcaccugcaccuac

 - 42

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).