Stem-loop sequence bdi-MIR530b

AccessionMI0029169 (change log)
DescriptionBrachypodium distachyon miR530b stem-loop
Gene family MIPF0000521; MIR530
Stem-loop
      aua                   ac          caaggaauggucuacauucaccuugcauaugaugcaugu 
5' gug   gugauugagcugcauuugc  cugcaccuac                                       a
   |||   |||||||||||||||||||  ||||||||||                                       a
3' cac   cacuaacucgacguagacg  gacguggaug                                       g
      gaa                   gu          aguggauccuucucgcucucccaguuccuguaggaacga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
5: 16956889-16957043 [-]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR530b
bdi-MIR530b5: 16956889-16957043 [-]
bdi-MIR530a5: 16956517-16956678 [-]
Database links

Mature sequence bdi-miR530b

Accession MIMAT0035527
Sequence

17 - 

ugcauuugcaccugcaccuac

 - 37

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).