Stem-loop sequence bdi-MIR531

AccessionMI0029170 (change log)
DescriptionBrachypodium distachyon miR531 stem-loop
Stem-loop 
   --       g u     c     c       u    c 
5'   cgguggc a gcucg cggag agcgugc gggu u
     ||||||| | ||||| ||||| ||||||| ||||  
3'   gccaucg u ugagc gcuuc ucgcacg cccg u
   cu       g u     u     c       c    a
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 9542419-9542492 [+]
intergenic
Database links

Mature sequence bdi-miR531

Accession MIMAT0035528
Sequence

8 -  

gaugcucgccggagcagcgugcug

 - 31

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).