Stem-loop sequence bdi-MIR845

AccessionMI0029171 (change log)
DescriptionBrachypodium distachyon miR845 stem-loop
Stem-loop
   --                    c          au   uaacc    a 
5'   ugauuuucuugcucugauac aauuguuggu  cag     ucug u
     |||||||||||||||||||| ||||||||||  |||     |||| a
3'   acuaagagagcgagacuaug uuaacaacca  guc     agau c
   ua                    c          -c   -ugcu    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 17791439-17791533 [-]
intergenic
Database links

Mature sequence bdi-miR845

Accession MIMAT0035529
Sequence

10 - 

ugcucugauaccaauuguugg

 - 30

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).