![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bdi-MIR1432 |
|||||
Accession | MI0029172 (change log) | ||||
Description | Brachypodium distachyon miR1432 stem-loop | ||||
Stem-loop |
-- u a g au u u -----uc uc ucaa 5' uccu uguucagg gagaugacacc ac cga c gauggg ggc agu u |||| |||||||| ||||||||||| || ||| | |||||| ||| ||| 3' agga acaagucc cucuacugugg ug guu g cuaccu ccg uca u gc u c g ag c c gugugua ga uuga |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bdi-miR1432 |
|
Accession | MIMAT0035530 |
Sequence |
8 - uucaggagagaugacaccgaca - 29 |
Evidence | not experimental |
References |
|
1 |
PMID:24367943
"Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon"
Genome Biol. 14:R145(2013).
|