Stem-loop sequence bdi-MIR1432

AccessionMI0029172 (change log)
DescriptionBrachypodium distachyon miR1432 stem-loop
Stem-loop
   --    u        a           g  au   u u      -----uc   uc   ucaa 
5'   uccu uguucagg gagaugacacc ac  cga c gauggg       ggc  agu    u
     |||| |||||||| ||||||||||| ||  ||| | ||||||       |||  |||     
3'   agga acaagucc cucuacugugg ug  guu g cuaccu       ccg  uca    u
   gc    u        c           g  ag   c c      gugugua   ga   uuga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 18961246-18961366 [+]
intergenic
Database links

Mature sequence bdi-miR1432

Accession MIMAT0035530
Sequence

8 - 

uucaggagagaugacaccgaca

 - 29

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).