Stem-loop sequence bdi-MIR2118a

AccessionMI0029173 (change log)
DescriptionBrachypodium distachyon miR2118a stem-loop
Gene family MIPF0000745; MIR2118
Literature search

3 open access papers mention bdi-MIR2118a
(31 sentences)

Stem-loop
      aau     g    uc           gagaa   g  cuu                  -a   gga       - ug cuu   uu           aag 
5' gac   gugag cagg  gggaagaggaa     gag gc   agagcagugggaguggga  cau   ggaaagc c  a   gcu  guuuucaccuc   u
   |||   ||||| ||||  |||||||||||     ||| ||   ||||||||||||||||||  |||   ||||||| |  |   |||  |||||||||||    
3' uug   cgcuc guuu  cccuucuccuu     cuc cg   ucuuguuauccuuacccu  gua   ccuuucg g  u   ugg  caagaguggag   g
      acu     g    -u           ----g   a  agc                  cc   --g       u gu ---   uu           guu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
5: 13861046-13861241 [-]
intergenic
Database links

Mature sequence bdi-miR2118a

Accession MIMAT0035531
Sequence

130 - 

uuuccgaugccucccauuccua

 - 151

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).