Stem-loop sequence bdi-MIR2275b

AccessionMI0029176 (change log)
DescriptionBrachypodium distachyon miR2275b stem-loop
Literature search

2 open access papers mention bdi-MIR2275b
(5 sentences)

Stem-loop
   ----    c   c         a c    -        gg           uauu 
5'     uaua aug gcuguucaa g gagg auuagaag  acugaaucauc    a
       |||| ||| ||||||||| | |||| ||||||||  |||||||||||     
3'     gugu uac ugguaaguu c cucu uaaucuuc  ugacuugguag    g
   cgaa    c   c         c a    a        uu           uaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 13941819-13941925 [+]
intergenic
Database links

Mature sequence bdi-miR2275b

Accession MIMAT0035534
Sequence

62 - 

uucaguuucuucuaauaucuca

 - 83

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).