Stem-loop sequence bdi-MIR5169b

AccessionMI0029178 (change log)
DescriptionBrachypodium distachyon miR5169b stem-loop
Gene family MIPF0001872; MIR5169
Stem-loop
   -----------------------------------------------------------------------------------auuguuugaccaaguuuguagaacaauau    ac        c c     u   uu      
5'                                                                                                                 cuca  aucuacaa a uaaau agu  uauua 
                                                                                                                   ||||  |||||||| | ||||| |||  |||| g
3'                                                                                                                 gagu  uagauguu u guuua uca  auagu 
   uaacaagauguuugaaccagcuuguuauuauucgaucaaacuaagcccuguuucgaucuugggaauauaaaaucuugcuucccucauuagaaucagacaucguuuugaaacu    -a        a a     u   -u      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
5: 20527327-20527532 [-]
intergenic
Database links

Mature sequence bdi-miR5169b

Accession MIMAT0035536
Sequence

5 - 

uuugaccaaguuuguagaaca

 - 25

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).