Stem-loop sequence bdi-MIR5171b

AccessionMI0029179 (change log)
DescriptionBrachypodium distachyon miR5171b stem-loop
Gene family MIPF0000382; MIR1122
Literature search

1 open access papers mention bdi-MIR5171b
(1 sentences)

Stem-loop
   ----------------------------uacuugugcacaacauggcguuuuacuccc     ga             -g    auuacacauaucuagaagauuuuugg 
5'                                                           uccgu  cauauuaagugac  aaau                          u
                                                             |||||  |||||||||||||  ||||                          a
3'                                                           aggca  guauaauucacug  uuua                          u
   guacuaauagauuuuugccuauccuaacaugucuaaauuguagaacaaaacauuaaga     gg             ag    gacagguuuauaucuacauagauaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 11086341-11086534 [-]
intergenic
Database links

Mature sequence bdi-miR5171b

Accession MIMAT0035537
Sequence

120 - 

acuuaauaugggacggaagaa

 - 140

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).