Stem-loop sequence bdi-MIR5281b

AccessionMI0029181 (change log)
DescriptionBrachypodium distachyon miR5281b stem-loop
Stem-loop
   --      cu -     uagu             c   c    --uca    cc   cucua        ga c   aua   g   -    ac    aucuacaacuuuauaccaagcuuuauuaaau 
5'   acuacu  c uuccu    uuuauaagauguu ugg uuug     uaua  aag     caaaccuu  c aag   aua uaa aucg  cgac                               c
     ||||||  | |||||    ||||||||||||| ||| ||||     ||||  |||     ||||||||  | |||   ||| ||| ||||  ||||                               u
3'   ugaugg  g aagga    aaauauucuacaa auc aaac     auau  uuc     guuuggag  g uuc   uau auu uagu  guug                               a
   ga      ag c     ---u             u   a    ucaaa    aa   ----a        -a u   aaa   g   a    -c    aagaguuuauuuauauucuauagauaacguu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 48737185-48737430 [-]
intergenic
Database links

Mature sequence bdi-miR5281b

Accession MIMAT0035539
Sequence

220 - 

ucuuauaaauaggaacggagg

 - 240

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).