Stem-loop sequence bdi-MIR5281a

AccessionMI0029183 (change log)
DescriptionBrachypodium distachyon miR5281a stem-loop
Stem-loop
   --ac                          c          a 
5'     ucccuucguuccuauuuauaagacgu uuggcaaguc a
       |||||||||||||||||||||||||| |||||||||| u
3'     agggaggcaaggauaaauauucugca aaccguucgg u
   caua                          a          u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 11656552-11656636 [+]
intergenic
Database links

Mature sequence bdi-miR5281a

Accession MIMAT0035540
Sequence

59 - 

ucuuauaaauaggaacggagg

 - 79

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).