Stem-loop sequence bdi-MIR5200b

AccessionMI0029234 (change log)
DescriptionBrachypodium distachyon miR5200b stem-loop
Gene family MIPF0001904; MIR5200
Literature search

3 open access papers mention bdi-MIR5200b
(19 sentences)

Stem-loop
   --ca  ag           a           c     -     c    uuc 
5'     cu  uaaagccuuag gaguaucuaca uggua guauu uucu   u
       ||  ||||||||||| ||||||||||| ||||| ||||| ||||    
3'     ga  auuucggaauc cucauagaugu accgu cauga aagg   u
   ggag  ca           c           c     u     a    ugg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 47483427-47483527 [+]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR5200b
bdi-MIR5200b1: 47483427-47483527 [+]
bdi-MIR5200c1: 47483433-47483519 [-]
Database links

Mature sequence bdi-miR5200b-5p

Accession MIMAT0035546
Sequence

11 - 

gccuuagagaguaucuacacu

 - 31

Get sequence
Evidence not experimental

Mature sequence bdi-miR5200b-3p

Accession MIMAT0035547
Sequence

71 - 

uguagauacucccuaaggcuu

 - 91

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).