Stem-loop sequence dvi-mir-190

AccessionMI0029243 (change log)
DescriptionDrosophila virilis miR-190 stem-loop
Gene family MIPF0000076; mir-190
Stem-loop
   cccacucauc   ug  uc      -            au      u  uu  auu 
5'           uaa  au  caguaa gauauguuugau  ucuugg ug  ac   c
             |||  ||  |||||| ||||||||||||  |||||| ||  ||    
3'           guu  ua  gucauu uuauacaaacua  aggacc ac  ug   a
   ucaucucaaa   gu  gu      a            --      c  -u  aaa 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_13049: 6215364-6215473 [+]
intergenic
Database links

Mature sequence dvi-miR-190-5p

Accession MIMAT0035560
Sequence

25 - 

agauauguuugauauucuugguug

 - 48

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dvi-miR-190-3p

Accession MIMAT0035561
Sequence

66 - 

cccaggaaucaaacauauuauua

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).