Stem-loop sequence dvi-mir-193

AccessionMI0029244 (change log)
DescriptionDrosophila virilis miR-193 stem-loop
Stem-loop
   ---a  c  --g   c         g         uu   au   c  ----uuau       u 
5'     ag gu   ugc cucauuaua uugggauuu  uag  cag ag        ugauaua a
       || ||   ||| ||||||||| |||||||||  |||  ||| ||        |||||||  
3'     uc ca   aug ggguaauau aacucugaa  auc  guc uc        gcuaugu u
   ugac  -  aaa   a         -         uc   cg   a  uucuaaau       a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_13049: 17910650-17910768 [+]
intergenic
Database links

Mature sequence dvi-miR-193-5p

Accession MIMAT0035562
Sequence

20 - 

aguugggauuuuuuagaucagc

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dvi-miR-193-3p

Accession MIMAT0035563
Sequence

76 - 

acuggccuacuaagucuca

 - 94

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).