Stem-loop sequence dvi-mir-252

AccessionMI0029245 (change log)
DescriptionDrosophila virilis miR-252 stem-loop
Gene family MIPF0000285; mir-252
Literature search

1 open access papers mention dvi-mir-252
(2 sentences)

Stem-loop
   uua   u   acc     aua       cc        a u  c      guua   -    g 
5'    guu gug   aggac   uugcuuu  uaaguacu g gc gcagga    ggu uugu u
      ||| |||   |||||   |||||||  |||||||| | || ||||||    ||| ||||  
3'    cga cac   uuuug   agcgaaa  auucguga c cg cguccu    ccg aacg c
   -aa   c   --c     auc       uu        a c  u      ----   u    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12855: 2861497-2861616 [+]
intergenic
Database links

Mature sequence dvi-miR-252-5p

Accession MIMAT0035564
Sequence

30 - 

cuaaguacuagugccgcaggag

 - 51

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dvi-miR-252-3p

Accession MIMAT0035565
Sequence

75 - 

ccugcugcccaagugcuuauu

 - 95

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).