Stem-loop sequence dvi-mir-929

AccessionMI0029249 (change log)
DescriptionDrosophila virilis miR-929 stem-loop
Gene family MIPF0000447; mir-929
Stem-loop
   gccaagugcg  g   ----gaau    gcc c       a        ag         -   u 
5'           ac cgu        uccu   g aguucaa uugacucu  uagggaguc cuu c
             || |||        ||||   | ||||||| ||||||||  ||||||||| |||  
3'           ug gca        agga   c uuaaguu gacugagg  aucccucag gag a
   --------aa  a   acagaccc    -aa a       a        ca         c   c 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12822: 1418797-1418914 [+]
intergenic
Database links

Mature sequence dvi-miR-929-5p

Accession MIMAT0035572
Sequence

35 - 

aaauugacucuaguagggagu

 - 55

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).