Stem-loop sequence dvi-mir-9538

AccessionMI0029277 (change log)
DescriptionDrosophila virilis miR-9538 stem-loop
Stem-loop
   uauua    uu   uaa          u c   ug   c   gu  a 
5'      guuc  ggu   aauuguucug c ggu  cuc ucu  gu u
        ||||  |||   |||||||||| | |||  ||| |||  ||  
3'      cagg  cca   uuaauaagac g cua  gag aga  cg u
   aaaaa    uc   uag          u a   --   u   ac  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12855: 6282625-6282718 [+]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-9538
dvi-mir-9538scaffold_12855: 6282625-6282718 [+]
dvi-mir-9538bscaffold_12855: 6282879-6282946 [+]
dvi-mir-9700ascaffold_12855: 6284216-6284276 [-]
dvi-mir-9700bscaffold_12855: 6284220-6284277 [+]
dvi-mir-9701ascaffold_12855: 6284350-6284416 [-]
dvi-mir-9701bscaffold_12855: 6284353-6284417 [+]
dvi-mir-9539scaffold_12855: 6284648-6284774 [+]
dvi-mir-9540scaffold_12855: 6284791-6284883 [+]
dvi-mir-9702scaffold_12855: 6286659-6286719 [+]
dvi-mir-9703scaffold_12855: 6286827-6286888 [+]
Database links

Mature sequence dvi-miR-9538-5p

Accession MIMAT0035618
Sequence

19 - 

auuguucuguccgguugcu

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dvi-miR-9538-3p

Accession MIMAT0035619
Sequence

57 - 

augagaucagucagaauaauuga

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).