Stem-loop sequence dvi-mir-9544a

AccessionMI0029282 (change log)
DescriptionDrosophila virilis miR-9544 stem-loop
Stem-loop
   a   -    uu  -   aauu            a      a a    u     a        uuu 
5'  aca aagu  au uug    ugagucauauga auuugc c gugg cuuuu uaacgagu   u
    ||| ||||  || |||    |||||||||||| |||||| | |||| ||||| ||||||||   g
3'  ugu uucg  ug aac    auucgguguacu uaaacg g cgcc gagaa auugcuca   u
   -   a    uu  c   ccgu            c      c c    -     a        cau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12970: 9428974-9429102 [-]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-9544a
dvi-mir-9544cscaffold_12970: 9429631-9429694 [-]
dvi-mir-9545scaffold_12970: 9429441-9429543 [-]
dvi-mir-9544bscaffold_12970: 9429010-9429070 [+]
dvi-mir-9544ascaffold_12970: 9428974-9429102 [-]
dvi-mir-9709scaffold_12970: 9428722-9428838 [-]
dvi-mir-9541ascaffold_12970: 9428406-9428469 [+]
dvi-mir-9541bscaffold_12970: 9428404-9428468 [-]
dvi-mir-9710scaffold_12970: 9428001-9428064 [-]
dvi-mir-9543ascaffold_12970: 9427846-9427976 [-]
dvi-mir-9711scaffold_12970: 9427098-9427154 [-]
dvi-mir-9720scaffold_12970: 9426838-9426903 [+]
dvi-mir-9712scaffold_12970: 9426825-9426912 [-]
dvi-mir-9714scaffold_12970: 9426640-9426709 [+]
dvi-mir-9713scaffold_12970: 9426638-9426704 [-]
dvi-mir-9721scaffold_12970: 9419681-9419786 [-]
dvi-mir-9542dscaffold_12970: 9419392-9419452 [-]
dvi-mir-9542ascaffold_12970: 9418994-9419089 [-]
Database links

Mature sequence dvi-miR-9544a-5p

Accession MIMAT0035628
Sequence

34 - 

uuugcacaguggucuuuuauaac

 - 56

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence dvi-miR-9544a-3p

Accession MIMAT0035629
Sequence

76 - 

uaaaagagccgccgcgca

 - 93

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).
2
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).