Stem-loop sequence dvi-mir-9546

AccessionMI0029286 (change log)
DescriptionDrosophila virilis miR-9546 stem-loop
Stem-loop
   acguu    -  u    -            ua        -    ug  a 
5'      ucgu cu ggau uuuaaggauuua  acaaauuu cauu  uu u
        |||| || |||| ||||||||||||  |||||||| ||||  ||  
3'      agca gg ccua agauuccuaagu  uguuuaaa guaa  ga u
   ugaac    c  u    c            ca        a    uu  u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_13042: 4534963-4535061 [+]
intergenic
Database links

Mature sequence dvi-miR-9546-5p

Accession MIMAT0035636
Sequence

19 - 

uaaggauuuauaacaaauuu

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dvi-miR-9546-3p

Accession MIMAT0035637
Sequence

59 - 

aaaauuuguacugaauccuuaga

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).