Stem-loop sequence dvi-mir-9549

AccessionMI0029289 (change log)
DescriptionDrosophila virilis miR-9549 stem-loop
Stem-loop
   uuugg  a     --   -acuugcg        a     c   g      caa        --     c 
5'      gc auuug  gcu        cuguugau uccag agu uuagca   guccuuug  uauug a
        || |||||  |||        |||||||| ||||| ||| ||||||   ||||||||  ||||| a
3'      cg uagac  cga        gacgauua agguu uca aaucgu   caggaagc  auaac c
   gagua  g     gu   caccuaaa        a     a   g      cuc        uu     c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_13049: 3076866-3077003 [+]
intergenic
Database links

Mature sequence dvi-miR-9549-5p

Accession MIMAT0035642
Sequence

38 - 

caguguuagcacaaguccuuug

 - 59

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dvi-miR-9549-3p

Accession MIMAT0035643
Sequence

79 - 

aaggaccucugcuaagacuau

 - 99

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).