Stem-loop sequence cli-let-7a-2

AccessionMI0029883 (change log)
DescriptionColumba livia let-7a-2 stem-loop
Stem-loop
   ugcaucc   uu   g   u             uagaa ua a 
5'        agg  gag uag agguuguauaguu     u  c c
          |||  ||| ||| |||||||||||||     |  | c
3'        ucc  uuc auc uccaacaugucaa     a  g a
   ------u   -u   g   c             --uag gg a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375651.1: 862705-862784 [-]
intergenic
Clustered miRNAs
< 10kb from cli-let-7a-2
cli-mir-100-1KB375651.1: 869665-869754 [-]
cli-let-7a-2KB375651.1: 862705-862784 [-]
Database links

Mature sequence cli-let-7a-5p

Accession MIMAT0038374
Sequence

12 - 

ugagguaguagguuguauaguu

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-let-7a-2-3p

Accession MIMAT0038376
Sequence

57 - 

cuguacaaccuccuagcuuucc

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).