Stem-loop sequence cli-let-7b

AccessionMI0029886 (change log)
DescriptionColumba livia let-7b stem-loop
Stem-loop
   -------------------  au                     ucaggguagugauuu 
5'                    gg  gagguaguagguugugugguu               u
                      ||  |||||||||||||||||||||                
3'                    cc  uuccgucauccaacauaucaa               g
   caacaauacgacgaauagu  -c                     uagaggacugacccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375672.1: 359882-359981 [-]
intergenic
Clustered miRNAs
< 10kb from cli-let-7b
cli-let-7a-3KB375672.1: 360757-360847 [-]
cli-let-7bKB375672.1: 359882-359981 [-]
Database links

Mature sequence cli-let-7b-3p

Accession MIMAT0038378
Sequence

60 - 

cuauacaaccuacugccuucc

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).