Stem-loop sequence cli-let-7c

AccessionMI0029887 (change log)
DescriptionColumba livia let-7c stem-loop
Stem-loop
   -  a      uu   g   u             ua  g ua a 
5'  gc uccggg  gag uag agguuguaugguu  ga u  c c
    || ||||||  ||| ||| |||||||||||||  || |  | c
3'  cg agguuc  uuc auc uccaacaugucaa  uu a  g c
   a  -      cu   g   u             --  g gg u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375804.1: 18430659-18430743 [+]
intergenic
Clustered miRNAs
< 10kb from cli-let-7c
cli-mir-99KB375804.1: 18429898-18429988 [+]
cli-let-7cKB375804.1: 18430659-18430743 [+]
Database links

Mature sequence cli-let-7c-5p

Accession MIMAT0038379
Sequence

11 - 

ugagguaguagguuguaugguu

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-let-7c-3p

Accession MIMAT0038380
Sequence

56 - 

cuguacaaccuucuagcuuucc

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).