Stem-loop sequence cli-let-7d

AccessionMI0029888 (change log)
DescriptionColumba livia let-7d stem-loop
Stem-loop
   ----     a              c      uuagggcagggauu 
5'     uagga gagguaguagguug auaguu              u
       ||||| |||||||||||||| ||||||               
3'     auucu uuccgucguccaac uaucaa              u
   cggg     -              a      uggaggaacacucg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375849.1: 23611-23697 [+]
intergenic
Clustered miRNAs
< 10kb from cli-let-7d
cli-let-7a-1KB375849.1: 22163-22253 [+]
cli-let-7fKB375849.1: 22603-22704 [+]
cli-let-7dKB375849.1: 23611-23697 [+]
Database links

Mature sequence cli-let-7d-5p

Accession MIMAT0038381
Sequence

6 - 

agagguaguagguugcauaguu

 - 27

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-let-7d-3p

Accession MIMAT0038382
Sequence

60 - 

cuauacaaccugcugccuuucu

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).