Stem-loop sequence cli-let-7e

AccessionMI0029889 (change log)
DescriptionColumba livia let-7e stem-loop
Stem-loop
   cug     g   cu   gu         a      -  ------    uc 
5'    uccuu agg  gag  aguagauug auaguu gu      ggag  c
      ||||| |||  |||  ||||||||| |||||| ||      ||||  g
3'    aggaa ucc  uuc  ucaucuaac uaucaa cg      ccuc  a
   -ag     -   -u   ug         a      a  aguuuc    cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375734.1: 1198016-1198108 [-]
intergenic
Clustered miRNAs
< 10kb from cli-let-7e
cli-let-7eKB375734.1: 1198016-1198108 [-]
cli-let-7a-4KB375734.1: 1197811-1197895 [-]
Database links

Mature sequence cli-let-7e-5p

Accession MIMAT0038383
Sequence

14 - 

ugagguaguagauugaauaguu

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-let-7e-3p

Accession MIMAT0038384
Sequence

64 - 

cuauacaaucuacugucuuucc

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).