Stem-loop sequence cli-let-7g

AccessionMI0029891 (change log)
DescriptionColumba livia let-7g stem-loop
Stem-loop
   uucuugc   a        u        a            ugagg    -a  a    a 
5'        cug uuccaggc gagguagu guuuguacaguu     gucu  ug uacc c
          ||| |||||||| |||||||| ||||||||||||     ||||  || ||||  
3'        gac aggguccg uuccguca cggacaugucaa     uaga  ac augg c
   ------a   -        -        c            -----    gg  -    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375633.1: 757937-758043 [-]
intergenic
Database links

Mature sequence cli-let-7g-5p

Accession MIMAT0038387
Sequence

20 - 

ugagguaguaguuuguacaguu

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-let-7g-3p

Accession MIMAT0038388
Sequence

77 - 

cuguacaggccacugccuugcc

 - 98

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).