Stem-loop sequence cli-let-7i

AccessionMI0029892 (change log)
DescriptionColumba livia let-7i stem-loop
Stem-loop
   c    u                 u   --------  u     ugu 
5'  uggc gagguaguaguuugugc guu        gg cgggu   g
    |||| ||||||||||||||||| |||        || |||||   a
3'  aucg uuccgucaucgaacgcg caa        uc gcccg   c
   -    -                 u   uagaggug  -     uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375322.1: 1403720-1403803 [-]
intergenic
Database links

Mature sequence cli-let-7i-5p

Accession MIMAT0038389
Sequence

6 - 

ugagguaguaguuugugcuguug

 - 28

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-let-7i-3p

Accession MIMAT0038390
Sequence

62 - 

cugcgcaagcuacugccuugcu

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).