Stem-loop sequence cli-mir-1a-1

AccessionMI0029893 (change log)
DescriptionColumba livia miR-1a-1 stem-loop
Stem-loop
    ug       g                gc     u -aa c 
5' c  cuugaga acauacuucuuuauau  ccaua g   c u
   |  ||||||| ||||||||||||||||  ||||| |   |  
3' g  ggacuuu uguaugaagaaaugua  gguau c   g g
    gu       a                -a     - gaa g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375315.1: 3131813-3131893 [-]
intergenic
Database links

Mature sequence cli-miR-1a-5p

Accession MIMAT0038391
Sequence

12 - 

acauacuucuuuauaugcccaua

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-1a-3p

Accession MIMAT0038392
Sequence

51 - 

uggaauguaaagaaguauguau

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).