Stem-loop sequence cli-mir-1a-2

AccessionMI0029894 (change log)
DescriptionColumba livia miR-1a-2 stem-loop
Stem-loop
   gua      c                     ac     ugaaca 
5'    ccugcc agaguacauacuucuuuaugu  ccaua      u
      |||||| |||||||||||||||||||||  |||||       
3'    ggacgg uuuuauguaugaagaaaugua  gguau      a
   uac      u                     -a     cguaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375298.1: 298704-298792 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-1a-2
cli-mir-1a-2KB375298.1: 298704-298792 [-]
cli-mir-133a-1KB375298.1: 295624-295715 [-]
Database links

Mature sequence cli-miR-1a-2-5p

Accession MIMAT0038393
Sequence

16 - 

acauacuucuuuauguacccaua

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-1a-3p

Accession MIMAT0038392
Sequence

55 - 

uggaauguaaagaaguauguau

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).