Stem-loop sequence cli-mir-1b

AccessionMI0029895 (change log)
DescriptionColumba livia miR-1b stem-loop
Stem-loop
     -u     ccc            c    ac     ugga   g 
5' cc  cccaa   uacauacuucuu auau  ccaua    guc g
   ||  |||||   |||||||||||| ||||  |||||    |||  
3' gg  ggguu   auguaugaagaa ugua  gguau    cgg c
     uc     uuu            u    -a     --ug   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375684.1: 951010-951095 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-1b
cli-mir-1bKB375684.1: 951010-951095 [-]
cli-mir-133cKB375684.1: 950877-950964 [-]
Database links

Mature sequence cli-miR-1b-5p

Accession MIMAT0038394
Sequence

12 - 

uacauacuucuucauauacccau

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-1b-3p

Accession MIMAT0038395
Sequence

54 - 

uggaauguuaagaaguauguauu

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).