Stem-loop sequence cli-mir-7a-1

AccessionMI0029896 (change log)
DescriptionColumba livia miR-7a-1 stem-loop
Stem-loop
   guu     a  u        a     a       u      --     a 
5'    ggucu gu cugugugg agacu gugauuu guuguu  uuuag u
      ||||| || |||||||| ||||| ||||||| ||||||  |||||  
3'    ucaga ca gauauacc ucuga cgcuaaa caacag  aaauc a
   gug     -  c        g     -       -      uu     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375705.1: 147000-147094 [+]
intergenic
Database links

Mature sequence cli-miR-7a-5p

Accession MIMAT0038396
Sequence

18 - 

uggaagacuagugauuuuguuguu

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-7a-3p

Accession MIMAT0038397
Sequence

60 - 

caacaaaucgcagucugccaua

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).