Stem-loop sequence cli-mir-7a-2

AccessionMI0029897 (change log)
DescriptionColumba livia miR-7a-2 stem-loop
Stem-loop
   -  u   ca  u    cu  a     a       u     u  au  cu 
5'  gg gcc  gc cccu  gg agacu gugauuu guugu gu  gg  c
    || |||  || ||||  || ||||| ||||||| ||||| ||  ||   
3'  uc cgg  cg ggga  cc ucuga cacugaa caaca ca  cc  a
   c  -   ug  u    uc  g     -       -     c  --  cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375424.1: 999171-999264 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-7a-2
cli-mir-7a-2KB375424.1: 999171-999264 [-]
cli-mir-1720KB375424.1: 999045-999123 [-]
Database links

Mature sequence cli-miR-7a-5p

Accession MIMAT0038396
Sequence

17 - 

uggaagacuagugauuuuguuguu

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-7a-2-3p

Accession MIMAT0038398
Sequence

59 - 

caacaagucacagucugcccua

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).