Stem-loop sequence cli-mir-9-1

AccessionMI0029900 (change log)
DescriptionColumba livia miR-9-1 stem-loop
Stem-loop
   uca       guug   uc               g      ug  g 
5'    gggguug    uua  uuugguuaucuagcu uaugag  gu u
      |||||||    |||  ||||||||||||||| ||||||  ||  
3'    ccccaau    aau  aagccaauagaucga auacuu  ua c
   uua       -aaa   ga               a      cu  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375676.1: 120312-120404 [-]
intergenic
Database links

Mature sequence cli-miR-9-5p

Accession MIMAT0038401
Sequence

18 - 

ucuuugguuaucuagcuguauga

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9-3p

Accession MIMAT0038402
Sequence

57 - 

auaaagcuagauaaccgaaagua

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).