Stem-loop sequence cli-mir-9-2

AccessionMI0029901 (change log)
DescriptionColumba livia miR-9-2 stem-loop
Stem-loop
   agg    u     g   uc               g      ug u 
5'    gaag gaguu uua  uuugguuaucuagcu uaugag  u u
      |||| ||||| |||  ||||||||||||||| ||||||  |  
3'    cuuc cucaa aau  aagccaauagaucga auacuu  g u
   gaa    -     a   ga               a      cu g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375452.1: 234173-234263 [-]
intergenic
Database links

Mature sequence cli-miR-9-5p

Accession MIMAT0038401
Sequence

18 - 

ucuuugguuaucuagcuguauga

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9-3p

Accession MIMAT0038402
Sequence

55 - 

auaaagcuagauaaccgaaagua

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).