Stem-loop sequence cli-mir-9-3

AccessionMI0029902 (change log)
DescriptionColumba livia miR-9-3 stem-loop
Stem-loop
   accu    u       c c       a       g     g   a 
5'     gggu gguuuuu u uuugguu ucuagcu uauga ugu u
       |||| ||||||| | ||||||| ||||||| ||||| ||| g
3'     cucg ccaaaaa g aagccaa agaucga auacu aua u
   gucg    c       u u       g       a     -   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375474.1: 244969-245060 [+]
intergenic
Database links

Mature sequence cli-miR-9-5p

Accession MIMAT0038401
Sequence

18 - 

ucuuugguuaucuagcuguauga

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9-3-3p

Accession MIMAT0038403
Sequence

56 - 

uaaagcuagagaaccgaaugua

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).