Stem-loop sequence cli-mir-10b

AccessionMI0029904 (change log)
DescriptionColumba livia miR-10b stem-loop
Stem-loop
   uua     u        a    g     c          uga   u 
5'    cguug cuauauau cccu uagaa cgaauuugug   uau c
      ||||| |||||||| |||| ||||| ||||||||||   |||  
3'    guagc gguauaua gggg aucuu gcuuagacac   aua a
   aaa     u        a    -     a          -ug   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB376208.1: 612541-612632 [-]
intergenic
Database links

Mature sequence cli-miR-10b-5p

Accession MIMAT0038406
Sequence

17 - 

uacccuguagaaccgaauuugu

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-10b-3p

Accession MIMAT0038407
Sequence

58 - 

agauucgauucuaggggaaua

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).