Stem-loop sequence cli-mir-15a

AccessionMI0029906 (change log)
DescriptionColumba livia miR-15a stem-loop
Stem-loop
   uuggcauaac ua        ua         gggu   g 
5'           g  gcagcaca  augguuugu    uuu a
             |  ||||||||  |||||||||    |||  
3'           c  cgucgugu  uaccggacg    gga a
   aacauaaaaa uc        ua         ---u   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375372.1: 15185597-15185675 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-15a
cli-mir-15aKB375372.1: 15185597-15185675 [-]
cli-mir-16a-1KB375372.1: 15185451-15185535 [-]
Database links

Mature sequence cli-miR-15a-5p

Accession MIMAT0038410
Sequence

12 - 

uagcagcacauaaugguuugug

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-15a-3p

Accession MIMAT0038411
Sequence

49 - 

caggccauauugugcugccuc

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).