Stem-loop sequence cli-mir-15b

AccessionMI0029907 (change log)
DescriptionColumba livia miR-15b stem-loop
Stem-loop
   agg       gua  cu       c  c           g  cu 
5'    ccuuaaa   cu  agcagca au augguuugcau cu  a
      |||||||   ||  ||||||| || ||||||||||| ||  a
3'    ggaauuu   ga  ucgucgu ua uacuaagcgua ga  u
   gaa       aaa  uu       u  u           -  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375540.1: 1615616-1615705 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-15b
cli-mir-15bKB375540.1: 1615616-1615705 [+]
cli-mir-16a-2KB375540.1: 1615796-1615874 [+]
Database links

Mature sequence cli-miR-15b-5p

Accession MIMAT0038412
Sequence

17 - 

uagcagcacaucaugguuugca

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-15b-3p

Accession MIMAT0038413
Sequence

55 - 

cgaaucauuauuugcugcuuua

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).