Stem-loop sequence cli-mir-15c

AccessionMI0029908 (change log)
DescriptionColumba livia miR-15c stem-loop
Stem-loop
   ggg        a    ua     a  uc          gggac 
5'    cuuugagg gaug  gcagc ca  augguuugua     a
      |||||||| ||||  ||||| ||  ||||||||||      
3'    ggaacucc uuac  cgucg gu  uaccagacau     a
   aua        a    uc     g  cu          agagg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375349.1: 3554757-3554844 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-15c
cli-mir-15cKB375349.1: 3554757-3554844 [-]
cli-mir-16bKB375349.1: 3554281-3554373 [-]
Database links

Mature sequence cli-miR-15c-5p

Accession MIMAT0038414
Sequence

17 - 

uagcagcacaucaugguuugua

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-15c-3p

Accession MIMAT0038415
Sequence

53 - 

cagaccauucugggcugccuca

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).