Stem-loop sequence cli-mir-16a-2

AccessionMI0029910 (change log)
DescriptionColumba livia miR-16a-2 stem-loop
Stem-loop
   uu    c  --         ua        u  ag   aau 
5'   ccgc cu  agcagcacg  aauauugg gu  uaa   a
     |||| ||  |||||||||  |||||||| ||  |||    
3'   ggug ga  ucgucgugu  uuauaacc ca  auu   a
   --    c  au         ua        c  -a   cca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375540.1: 1615796-1615874 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-16a-2
cli-mir-15bKB375540.1: 1615616-1615705 [+]
cli-mir-16a-2KB375540.1: 1615796-1615874 [+]
Database links

Mature sequence cli-miR-16a-5p

Accession MIMAT0038416
Sequence

9 - 

uagcagcacguaaauauuggugu

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-16a-2-3p

Accession MIMAT0038418
Sequence

51 - 

cccaauauuauugugcugcuuaa

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).