Stem-loop sequence cli-mir-16b

AccessionMI0029911 (change log)
DescriptionColumba livia miR-16b stem-loop
Stem-loop
   cug     ag    cu       cgua          ---uu    a 
5'    ucagc  ugcu  agcagca    aauacuggag     uagg u
      |||||  ||||  |||||||    ||||||||||     ||||  
3'    ggucg  guga  ucgucgu    uuaugaccuc     gucc u
   aaa     ga    uu       uacg          ucguu    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375349.1: 3554281-3554373 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-16b
cli-mir-15cKB375349.1: 3554757-3554844 [-]
cli-mir-16bKB375349.1: 3554281-3554373 [-]
Database links

Mature sequence cli-miR-16b-5p

Accession MIMAT0038419
Sequence

16 - 

uagcagcacguaaauacuggagu

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-16b-3p

Accession MIMAT0038420
Sequence

58 - 

uccaguauugcauugcugcuuu

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).