Stem-loop sequence cli-mir-17

AccessionMI0029912 (change log)
DescriptionColumba livia miR-17 stem-loop
Stem-loop
   ugc     a       -ca        a  g     gua  gaua 
5'    gucag guaaugu   aagugcuu ca ugcag   gu    u
      ||||| |||||||   |||||||| || |||||   ||     
3'    caguu uauuacg   uucacgga gu acguc   ca    a
   cga     g       aug        a  g     auc  agau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375488.1: 2837957-2838047 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-17
cli-mir-17KB375488.1: 2837957-2838047 [-]
cli-mir-18aKB375488.1: 2837808-2837898 [-]
cli-mir-19aKB375488.1: 2837667-2837754 [-]
cli-mir-20aKB375488.1: 2837493-2837575 [-]
cli-mir-19b-1KB375488.1: 2837364-2837438 [-]
cli-mir-92-1KB375488.1: 2837243-2837324 [-]
Database links

Mature sequence cli-miR-17-5p

Accession MIMAT0038421
Sequence

17 - 

caaagugcuuacagugcaggua

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-17-3p

Accession MIMAT0038422
Sequence

55 - 

acugcagugaaggcacuuguagc

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).