Stem-loop sequence cli-mir-18a

AccessionMI0029913 (change log)
DescriptionColumba livia miR-18a stem-loop
Stem-loop
   agu         a   --   u   uc   u    a   -  aa u 
5'    gcuuuuugu cua  agg gca  uag gcag uag ug  g a
      ||||||||| |||  ||| |||  ||| |||| ||| ||  | g
3'    ugaagaaua ggu  ucc cgu  auc cguc auc ac  u a
   uau         c   cu   u   ga   c    -   u  ga u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375488.1: 2837808-2837898 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-18a
cli-mir-17KB375488.1: 2837957-2838047 [-]
cli-mir-18aKB375488.1: 2837808-2837898 [-]
cli-mir-19aKB375488.1: 2837667-2837754 [-]
cli-mir-20aKB375488.1: 2837493-2837575 [-]
cli-mir-19b-1KB375488.1: 2837364-2837438 [-]
cli-mir-92-1KB375488.1: 2837243-2837324 [-]
Database links

Mature sequence cli-miR-18a-5p

Accession MIMAT0038423
Sequence

15 - 

uaaggugcaucuagugcagaua

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-18a-3p

Accession MIMAT0038424
Sequence

56 - 

acugcccuaagugcuccuucuggc

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).