Stem-loop sequence cli-mir-18b

AccessionMI0029914 (change log)
DescriptionColumba livia miR-18b stem-loop
Stem-loop
   guu         --   u    c   u     ua  gaagu 
5'    cuuguguua  agg gcau uag gcagu  gu     a
      |||||||||  ||| |||| ||| |||||  ||     g
3'    gaacacggu  ucc cgua auc cguca  ua     c
   guc         cu   u    a   c     uc  agaug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375349.1: 3452301-3452383 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-18b
cli-mir-106KB375349.1: 3452467-3452537 [-]
cli-mir-18bKB375349.1: 3452301-3452383 [-]
cli-mir-20bKB375349.1: 3452099-3452195 [-]
cli-mir-19b-2KB375349.1: 3451977-3452067 [-]
cli-mir-92-2KB375349.1: 3451812-3451895 [-]
cli-mir-363KB375349.1: 3451668-3451762 [-]
Database links

Mature sequence cli-miR-18b-5p

Accession MIMAT0038425
Sequence

11 - 

uaaggugcaucuagugcagu

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-18b-3p

Accession MIMAT0038426
Sequence

54 - 

ugcccuaaaugcuccuucuggc

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).